General description: The associated file contains sediment pigment data from the antFOCE project 4127. Units: all pigment data in ug/g, 0 = below detection limit of HPLC. Sample collection details: At the start and end of the antFOCE experiment, four sediment core samples were taken from inside and outside each chamber or open plot by divers. The top 1 cm of the cores was then removed and placed in the dark, first at -20ºC for 2 hours, then at -80ºC until analysis at the Australian Antarctic division. Pigment analysis Frozen samples were transported under liquid N2 to a freeze drier (Dynavac, model FD-5), in pre-chilled flasks with a small amount of liquid N2 added. Custom made plumbing fitted to the freeze drier enabled samples to be purged with N2 to prevent photo-oxidation up until solvent extraction. Prior to pigment extraction five 2 g stainless steel ball bearings were added to homogenise the freeze dried sediment. The samples were bead beaten for 1 minute (Biospec products). Subsamples (~0.05 g) were immediately transferred to cryotubes with 700 µl of dimethylformamide (DMF) for two hours. Samples were kept at -80ºC and under a safe light (IFORD 902) at all times. All pigment concentrations are standardised to sediment weight. Pigments were extracted with dimethylformamide (DMF 700 µl) over a two hour period at -20ºC. Zirconia beads, and 100 µl of Apo 8 and an internal standard were added to each sub-sample. After a two hour extraction, sub-samples were bead beaten for 20 seconds and then placed in a centrifuge with filter cartridge inserts for 14 minutes at 2500 rpm at -9ºC to separate the solvent from the sediment. The supernatant was transferred into to a vial and placed in a precooled rpHPLC autosampler. The rpHPLC system used is described in Hodgson et al. (1997). Pigment detection was at 435, 470 and 665 nm for all chlorophylls and carotenoids, with spectra from 300–700 nm being collected every 0.2 seconds. Pigment identification was carried out using a combination of rpHPLC and normal phase HPLC retention times, light absorbance spectra and reference standards (see Hodgson et al., 1997). These techniques assisted in the accurate identification of pigments and their derivatives to a molecular level and enabled several pigment derivatives to be analysed. The HPLC was previously calibrated with authentic standards and protocols outlined in SCOR (1988). Data set headers: (A)Treatment: Example code 4127_SOP7_6-1-15_PlotB_R1, = prodject code_Standard Operating Procedure(SOP) used to collect samples(see antFOCE parent file)_ Date_Chamber/plot(A,B,C,D)_replicate core within Chamber/plot(1,2,3) (B) BB carot= BB caroten, type of pigment detected by HPLC. See Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more details. (C) Chl c1 = Chlorophyll derivatives see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (D) Chl c2 = Chlorophyll derivatives see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (E) Chl c3 = Chlorophyll derivative see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (F) Chla = Chlorophyll a see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (G) Ddx =Diadinoxanthin see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information (H) dtx = Diatoxanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information (I) epi = Chlorophyll epimer pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (j) Fuc = Fucoxanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (k) Gyro2 = Gyroxanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (L) Pras = Prasanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (m) Zea = Zeaxanthin pigment. see Wright, S.W., Jeffrey, S.W. and Mantoura, R.F.C. eds., 2005. Phytoplankton pigments in oceanography: guidelines to modern methods. Unesco Pub for more information. (n) Date = Samples taken at the start of antFOCE experiment or at the end (o) chamber = The antFOCE chamber (A,B,C,D) (p) Treatment = The associated pH level in chambers (Acidified ~7.8, Control ~8.2) (Q) Position = Samples were taken within chambers and outside chambers (outside, inside) (r) rep= Subsamples were taken within each chamber/position (R1=replicate one, R1-R4) Spatial coordinates: 66.311500 S, 110.514216 E Dates: between 1/12/2014 and 1/3/2015 Timezone:UTC+11

The Southern Ocean is one the most significant regions on earth for regulating the build up of anthropogenic CO2 in the atmosphere, and the capacity for carbon uptake in the region could be altered by climate change. The project aims to establish a time series of anthropogenic carbon accumulation. The work will be used to identify processes regulating the CO2 uptake and to test models that predict future uptake. These data were collected on the VMS voyage of the Aurora Australis in the 2010-2011 field season. Data include pH, carbon dioxide, alkalinity and spectrometer data.

Long-term experiment on increased CO2 level on krill physiology. Krill were exposed to a range of CO2 conditions 400-4000ppm over a year, and their growth, mortality, and physiology were monitored. -List of files- Ericson Krill Ocean Acidification Study Raw Data_for data centre.xlsx: This file contains data on krill growth, mortality, physiology, and biochemistry, as well as information on water chemistry throughout 1 year period of the experiment. Ericson et al. Adult krill OA MS final submission.pdf: Unpublished manuscript of the experiment including all methods of the experiment.

This data set was collected from a ocean acidification minicosm experiment performed at Davis Station, Antarctica during the 2014/15 summer season. It includes: - description of methods for all data collection and analyses. - flow cytometry counts; autotrophic cells, heterotrophic nanoflagellates, and prokaryotes

Refer to antFOCE report section 4.4.1 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 The download file contains an Excel workbook with 2 data spreadsheets - one for the greater than 1mm fraction and one for the 0.5mm to 1mm fraction of the macrofauna - and a third of notes relevant to the data. The data are the total number of each organism collected from sediment cores taken in and adjacent to chambers or open plots during the antFOCE experiment. Analysis methods are detailed in the Notes spreadsheet. Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – “antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis”. This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127

This dataset contains pulse amplitude modulated (PAM) fluorometry measurements and chlorophyll concentrations for a series of incubation experiments performed during the 2012 SIPEX marine science voyage. The PAM files are in a raw format, but can be opened using Microsoft Excel. Light curves have not been processed. Bloom potential: 4-8 ice cores were collected from 4 fast ice stations during SIPEXII (Stations 20120926, 20121006, 20121013, 20121019) and ice collected from the back of the ship (Underway ice collection). The bottom 3cm was shaved off each ice core into filtered seawater. The concentration of chlorophyll a in the slurry was measured using a Turner 10AU fluorometer and the physiological health was determined using a PAM fluorometer. 5 x 50ml cultures from each ice station were incubated for 15-30 days (~50uE, ~0.2 degrees). At the end of the incubation period, the physiological health of the cultures was measured again, as was chlorophyll a. Post-incubation samples were also collected to determine nutrient concentration and species composition. C02: Brine algae was collected from sack holes drilled to a depth of ~45cm from 3 fast ice stations during SIPEXII (Stations 20121006, 20121013, 20121019). PAM fluorometry was used to measure cell health prior to the brine solution being aliquoted into 50ml culture vials to produce 4 treatments: 0.1% CO2, 1% CO2, 2% CO2, control. Cultures were incubated for 7-12 days. Post incubation analyses included: PAM, chlorophyll a, DIC, TA and cell identification. Samples were also collected for DNA extraction, which was performed at sea. The files in this dataset are: 1. McMinn Bloom Dynamics folder. This folder contains raw PAM data from each of the experiments. This is highly specialised photophysiology data, please consult the Walz PAM manual (www.walz.com) for interpretation. The dates and duration of each incubation experiment can be determined from the raw data. 2. McMinn CO2 folder. This contains raw PAM data, dates and experiment duration.

Chlorophyll data was used to measure growth rates of sea ice algae in CO2 incubations. Sea ice brine microalgae was collected from sackholes. Replicate samples were incubated in ambient air (~0.04% CO2), 0.1% CO2, 1.0% CO2 and 2.0% CO2 concentrations. AT the end of the incubations the 50 ml samples were filtered through a 25 mm GF/F filter using vacuum filtration. The filters were placed in 15 ml plastic falcon tubes containing 10 ml of methanol, covered in aluminium foil and kept in the dark at 4 degrees C for 12 hours. Chl a concentration was measured using a 10AU Turner fluorometer following the acidification method of Strickland and Parsons (1972). Data in spread sheet shows the extracted chl + phaeophytin, phaeophytin and chlorophyll concentrations (micro grams l-1) for each of the three experiments. Data were collected at SIPEX Ice Stations 1-8 and SIPEX CTD stations 2-5

This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing of samples from Biofilm slides deployed as part of the antFOCE experiment in the austral summer of 2014/15 at Casey station, East Antarctica. Refer to antFOCE report section 4.5.3 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 Sampling design 2 trays of 8 horizontal standard glass microscope slides (72 x 25 mm) per chamber. Four of the glass slides were scored with a diamond pencil approximately 18 mm from the right hand end of the slide and deployed scored side up. The remaining four slides were unmodified. Slides were sampled at: - Tmid - one tray per chamber / open plot. The sampled try was repopulated with fresh slides and redeployed - Tend – 2 slides trays per chamber / open plot. Sampling procedure After 31 days deployment, 1 slide tray per chamber / open plot was sampled. At Tend both trays in each chamber / open plot were sampled. To minimize disturbance while being raised to the surface, each tray was removed from the tray holder by divers and placed in a seawater filled container with a lid. On the surface, slides were removed from the tray using ethanol sterilized forceps. The four unscoured slides per chamber / open plot were placed in a plastic microscope slide holder with a sealable lid. The scoured slides were placed individually in 70 ml plastic sample jars. Lab procedure - Casey The slide holder (4 unscoured slides) from each chamber / open plot was frozen at -20C immediately upon return to the lab. The scoured slides were preserved in sea water containing 1% final concentration glutaraldehyde in separate jars. Preservation Issue: Scoured slides were not refrigerated, either at Casey, during RTA or in Kingston before the 26th Nov 2015, when they were transferred to the 4C Cold Store. antFOCE Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 AntFOCE biofilm DNA methods Laurence Clarke, Shane Powell, Bruce Deagle DNA extraction The biofilm was removed from the top of each slide with a cotton swab and DNA extracted directly from the swab using the MoBio PowerBiofilm DNA isolation kit following the manufacturer’s protocol. Extraction blanks were extracted in parallel to detect contamination. Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing DNA extracts were PCR-amplified in triplicate with primers designed to amplify 140-170 bp of eukaryotic 18S ribosomal DNA (Jarman et al. 2013). The forward primer was modified to improve amplification of protists. Table 1. First and second round primers, including MID tags (Xs). ILF_ProSSU3'F_X TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG XXXXXX CACCGCCCGTCGCWMCTACCG ILR_SSU3'R_Y GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG XXXXXX GGTTCACCTACGGAAACCTTGTTACG msqFX AATGATACGGCGACCACCGAGATCTACAC XXXXXXXXXX TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG msqRY CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXX GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG PCR amplifications were performed in two rounds, the first to amplify the 18S region and add sample-specific multiplex-identifier (MID) tags and Illumina sequencing primers, the second to add the P5 and P7 sequencing adapters and additional MIDs. Each reaction mix for the first PCR contained 0.1 µM each of forward and reverse primer, 0.2 µg/µL BSA, 0.2 U Phusion DNA polymerase in 1 x Phusion Master Mix (New England Biolabs, Ipswich, MA, USA) and 1 micro L DNA extract in a total reaction volume of 10 micro L. PCR thermal cycling conditions were initial denaturation at 98 degrees C for 30 secs, followed by 25 cycles of 98 degrees C for 5 secs, 67 degrees C for 20 secs and 72 degrees C for 20 secs, with a final extension at 72 degrees C for 5 min. Replicate PCR products were pooled then diluted 1:10 and Illumina sequencing adapters added in a second round of PCR using the same reaction mix and thermal cycling conditions as the first round, except the concentration of BSA was halved (0.1 micro g/micro L), and the number of cycles was reduced to 10 with an annealing temperature of 55 degrees C. Products from each round of PCR were visualized on 2% agarose gels. Second round PCR products were pooled in equimolar ratios based on band intensity. The pooled products were purified using Agencourt AMPure XP beads (Beckman Coulter, Brea, CA, USA) and the concentration of the library measured using the Qubit dsDNA HS assay on a QUBIT 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). The pool was diluted to 2 nM and paired-end reads generated on a MiSeq (Illumina, San Diego, CA, USA) with MiSeq Reagent Nano kit vs (300-cycles). Bacterial 16S rDNA PCR amplification and high-throughput sequencing Bioinformatics Reads were sorted by sample-specific MIDs added in the second round PCR using the MiSeq Reporter software. Fastq reads were merged using the -fastq_mergepairs command in USEARCH v8.0.1623 (Edgar 2010). Merged reads were sorted by "internal" 6 bp MID tags, and locus-specific primers trimmed with custom R scripts using the ShortRead package (Morgan et al. 2009), with only reads containing perfect matches to the expected MIDs and primers retained. Reads for all samples were dereplicated and global singletons discarded (-derep_fulllength -minuniquesize 2), and clustered into OTUs with the UPARSE algorithm (Edgar 2013) using the '-cluster_otus' command. Potentially chimeric reads were also discarded during this step. Reads for each sample were then assigned to OTUs (-usearch_global -id .97), and an OTU table generated using a custom R script. Taxonomy was assigned to each OTU using MEGAN version 5.10.5 (Huson et al. 2011) based on 50 hits per OTU generated by BLASTN searches against the NCBI 'nt' database (downloaded August 2015). Default LCA parameters were used, except Min support = 1, Min score = 100, Top percent = 10. Alpha and beta-diversity analyses were performed based on a rarefied OTU table with QIIME v1.8.0 (alpha_rarefaction.py, beta_diversity_through_plots.py, Caporaso et al. 2010). References Caporaso JG, Kuczynski J, Stombaugh J, et al. (2010) QIIME allows analysis of high-throughput community sequencing data. Nature Methods 7, 335-336. Huson DH, Mitra S, Ruscheweyh HJ, Weber N, Schuster SC (2011) Integrative analysis of environmental sequences using MEGAN4. Genome Research 21, 1552-1560. Jarman SN, McInnes JC, Faux C, et al. (2013) Adelie penguin population diet monitoring by analysis of food DNA in scats. PLoS One 8, e82227.

Carbonate chemistry data for the antFOCE seawater samples. The download file contains an Excel spreadsheet with a number of worksheets detailing the samples collected from O'Brien Bay, Casey Station. The dataset includes information on oxygen levels, pH levels, temperature and salinity levels, as well as the concentrations of various elements (dissolved inorganic carbon, phosphate, nitrate, nitrite, silicate). Free-ocean CO2 enrichment (FOCE) experiments have been deployed in marine ecosystems to manipulate carbonate system conditions to those predicted in future oceans. We investigated whether the pH/carbonate chemistry of extremely cold polar waters can be manipulated in an ecologically relevant way, to represent conditions under future atmospheric CO2 levels, in an in-situ FOCE experiment in Antarctica. We examined spatial and temporal variation in local ambient carbonate chemistry at hourly intervals at two sites between December and February and compared these with experimental conditions. We successfully maintained a mean pH offset in acidified benthic chambers of -0.38 (plus or minus 0.07) from ambient for approximately 8 weeks. Local diel and seasonal fluctuations in ambient pH were duplicated in the FOCE system. Large temporal variability in acidified chambers resulted from system stoppages. The mean pH, Ωarag and fCO2 values in the acidified chambers were 7.688 plus or minus 0.079, 0.62 plus or minus 0.13 and 912 plus or minus 150 micro-atm respectively. Variation in ambient pH appeared to be mainly driven by salinity and biological production and ranged from 8.019 to 8.192 with significant spatio-temporal variation. This experiment demonstrates the utility of FOCE systems to create conditions expected in future oceans that represent ecologically relevant variation, even under polar conditions.

Refer to antFOCE report section 4.5.1 for deployment, sampling and analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 The download file contains an Excel workbook with one data spreadsheet and one of notes relevant to the data. The data are the total number of each sessile organism collected per tile as per the census methods detailed in the Notes spreadsheet. Tiles were deployed in chambers or open plots during the antFOCE experiment on a metal stand in either a horizontal or vertical orientation. Background The antFOCE experimental system was deployed in O’Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – “antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis”. This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127